Archives

Elution Volume of Saccharides and Organic Acids – Selectable Analytes

Conditions


 Column : Shodex SUGAR SH1011 (8.0mmID*300mm)
 Eluent : 5mM or 20mM H2SO4 aq.
 Flow rate : 0.6mL/min
 Detector : Shodex RI
 Column temp. : 60°C

Check the analytes you wish to COMPARE. Click the COMPARE button. You can RESET the table (page reload).


Saccharides & Sugar Alcohols

Saccharides/Sugar Alcohols (a)
5mM, min		 (b)
20mM, min		 (b)/(a), %
  Stachyose 8.59min 8.66min 100.85%
  Isomaltotriose 8.85 8.90 100.59
  Panose 8.94 8.98 100.48
  Maltotriose 9.03 9.09 100.65
  Gentiobiose 9.47 9.51 100.42
  Isomaltose 9.63 9.69 100.64
  Melibiose 9.77 9.82 100.51
  Kojibiose 9.79 9.83 100.44
  Maltose 9.80 9.86 100.60
  Trehalose 9.82 9.87 100.53
  Nigerose 9.87 9.87 99.99
  Palatinose 9.96 9.75 97.91
  Palatinit 9.96 10.04 100.77
  Trehalulose 9.97 10.02 100.51
  Lactose 9.99 10.05 100.55
  Xylobiose 10.09 10.15 100.52
  Maltitol 10.19 10.27 100.78
  Lactitol 10.45 10.54 100.84
  Glucose 11.32 11.37 100.47
  Sorbose 11.54 11.58 100.32
  1myo-Inositol 11.69 11.75 100.47
  D-Mannose 11.85 11.90 100.44
  D(+)-Galactose 11.89 11.94 100.44
  (+)-Xylose 11.92 11.97 100.43
  D(-)-Fructose 12.01 12.05 100.37
  Mannitol 12.26 12.34 100.63
  D(-)-Sorbitol 12.42 12.47 100.39
  9oD(+)-Rhamnose 12.46 12.51 100.41
  D(+)-Arabinose 12.74 12.79 100.40
  D(-)-Ribose 13.01 13.04 100.22
  D-Arabitol 13.07 13.14 100.57
  Xylitol 13.25 13.33 100.61
  D(+)-Fucose 13.35 13.40 100.40
  meso-Erythritol 13.81 13.89 100.60
  N-Acetyl-alpha-D-
glucosamine		 14.02 14.05 100.21
  N-Acetyl-alpha-D-
galactosamine		 15.47 15.49 100.12


Organic Acids

Organic Acids (a)
5mM, min		 (b)
20mM, min		 (b)/(a), %
  Oxalic acid 8.46min 9.38min 110.90%
  D-Glucuronic acid 10.24 10.39 101.46
  Citric acid 10.25 10.48 102.26
  alpha-Ketoglutaric acid 10.27 11.47 111.66
  Maleic acid 10.28 11.77 114.46
  N-Acetylneuramic acid 10.53 10.94 103.92
  Tartaric acid 10.67 11.06 103.65
  Pyruvic acid 11.48 12.79 111.36
  Malic acid 11.74 11.93 101.63
  Malonic acid 11.95 12.53 104.84
  trans-Aconitic acid 12.01 12.51 104.10
  Succinic acid 13.78 13.83 100.39
  DL-Lactic acid 14.73 14.86 100.85
  Formic acid 15.70 15.82 100.78
  Acetic acid 16.90 16.93 100.18
  Adipic acid 17.32 17.42 100.59
  Mesaconic acid 18.28 19.02 104.07
  L-Pyroglutamic acid 19.00 19.53 102.77
  Propionic acid 19.45 19.54 100.40

Alcohols

Alcohol (a)
5mM, min		 (b)
20mM, min		 (b)/(a), %
  Ethanol 23.43min 23.52min 100.38%


Column Test Conditions (Reversed Phase and Hydrophilic Interaction Chromatography Columns)

To check the deterioration of column performance, measure the column plate number and compare it with the number written in the inspection data sheet which is attached to the column. The test conditions for calculation of the plate number is determined for each column type and shown in the table below.
When you first use a column, we recommend you to measure its plate number before use. Plate number (N) can be calculated by the formula in the following figure.

s1030

 

Column type Test conditions
(1)Sample (2)Injection volume (3)Eluent (4)Flow rate (5)Temperature (6)Detector
ODP-50 6D
ODP-50 6E
ODP-50 4B
ODP-50 4D
ODP-50 4E
ODP-50 2D		 (1)0.75 μL/mL n-Hexyl benzoate (ODP-50 6D, ODP-50 6E, ODP-50 4B, ODP-50 4D, ODP-50 4E) 0.08 % n-Hexyl Benzoate (ODP-50 2D) (2)10 μL (ODP-50 6D), 17 μL (ODP-50 6E), 3 μL (ODP-50 4B), 6 μL (ODP-50 4D, ODP-50 4E.), 7 μL (ODP-50 2D), (3)CH3CN/H2O=65/35 (4)1.0 mL/min (ODP-50 6D, ODP-50 6E), 0.6 mL/min (ODP-50 4B, ODP-50 4D, ODP-50 4E), 0.2 mL/min (ODP-50 2D) (5)30 °C (ODP-50 6D, ODP-50 6E, ODP-50 4B, ODP-50 4D, ODP-50 4E), Ambient (ODP-50 2D) (6)UV (254 nm)
C4P-50 4D (1)0.75 μL/mL n-Hexyl benzoate (2)6 μL (3)CH3CN/H2O=65/35 (4)0.6 mL/min (5) 30 °C (6)UV (254 nm)
ODP2 HP-4B
ODP2 HP-4D
ODP2 HP-4E
ODP2 HP-2B
ODP2 HP-2D		 (1)1,000 mg/L Toluene (2)5 μL (ODP2 HP-4B, ODP2 HP-4D, ODP2 HP-4E), 2 μL (ODP2 HP-2B), 1 μL (ODP2 HP-2D) (3)H2O/CH3CN=55/45 (4)0.5 mL/min (ODP2 HP-4B, ODP2 HP-4D, ODP2 HP-4E), 0.1 mL/min (ODP2 HP-2B, ODP2 HP-2D) (5)40 °C (6)UV (254 nm)
DS-613 (1)0.1 % Benzene (2)20 μL (3) CH3CN/THF/H2O=40/30/30 (4)0.8 mL/min (5)Ambient (6)UV (254 nm)
DS-413 (1)1 % 3-Pentanone (2)5 μL (3) CH3CN/THF/H2O=30/30/40 (4)0.6 mL/min (5)Ambient (6)UV (262 nm)
DE-613 (1)0.2 % Ethylene glycol (2)20 μL (3) H2O (4)0.8 mL/min (5)Ambient (6)RI
DE-413 (1)0.6 % Di-n-butyl ketone (2)10 μL (DE-413), 20 μL (DE-413L) (3) CH3CN/H2O=50/50 (4)1.0 mL/min (5)40 °C (6)UV (262 nm)
DE-213 (1)0.6 % Di-n-butyl ketone (2)5 μL (3) CH3CN/H2O=50/50 (4)0.2 mL/min (5)40 °C(6)UV (262 nm)
DM-614 (1)2 % Oxalic acid (2)5 μL (3)5 mM H3PO4 aq. (4)0.8 mL/min (5)Ambient (6)RI
NN-814 (1)0.1 % Uracil (2)10 μL (3)0.1 M NaH2PO4 (pH3.0) (4)1.0 mL/min (5)35 °C (6)UV (260 nm)
JJ-50 2D (1)1.0 % Acetone (2)0.5 μL (3)CH3CN/H2O=60/40 (4)0.15 mL/min (5)Ambient (6)UV (280 nm)
VG-50 4D
VG-50 4E		 (1)5 mg/mL Sucrose (2)5 μL (3)CH3CN/H2O=80/20 (4)0.6 mL/min (VG-50 4D), 1.0 mL/min (VG-50 4E) (5)40 °C (6)RI
VG-50 2D (1)2 mg/mL Sucrose (2)1 μL (3)CH3CN/H2O=85/15 (4)0.2 mL/min (5)40 °C (6)RI
VT-50 2D (1)250 µg/mL Allantoin (2)2 μL (3)CH3CN/25 mM HCOONH4=85/15 (4)0.2 mL/min (5)40 °C (6)UV (210 nm)
VC-50 2D (1)50 µg/mL Uracil (2)2 μL (3)CH3CN/25 mM HCOOH=85/15 (4)0.1 mL/min (5)40 °C (6)UV (254 nm)
VN-50 4D
VN-50 2D		 (1)0.5 % Ethylene glycol (2)3 μL (VN-50 4D), 1 μL (VN-50 2D) (3)CH3CN/H2O=75/25 (4)0.6 mL/min (VN-50 4D), 0.1 mL/min (VN-50 2D) (5)30 °C (6)RI
NH2P-50 4B
NH2P-50 4D
NH2P-50 4E
NH2P-50 2D		 (1)5 mg/mL Sucrose (2)3 μL (NH2P-50 4B), 6 μL (NH2P-50 4D, NH2P-50 4E), 1.5 μL (NH2P-50 2D) (3)CH3CN/H2O=75/25 (4)0.6 mL/min (NH2P-50 4B, NH2P-50 4D), 1.0 mL/min (NH2P-50 4E), 0.2 mL/min (NH2P-50 2D) (5)30 °C (NH2P-50 4B, NH2P-50 4D, NH2P-50 4E), 35 °C (NH2P-50 2D) (6)RI
NH2P-40 3E (1)5 mg/mL Sucrose (2)4 μL (3)CH3CN/H2O=75/25 (4)0.35 mL/min (5)35 ℃ (6)RI
C18U 2B
C18U 2D		 (1)0.24 mg/mL Naphthalene (2)1 μL (3)CH3CN/H2O=60/40 (4)0.4 mL/min (5)Ambient (6)UV (254 nm)
C18M 4D
C18M 4E		 (1)0.61 mg/mL Naphthalene (2)1.5 μL (C18M 4D), 2 μL (C18M 4E) (3)CH3OH/H2O=70/30 (4)1.0 mL/min (5)30 °C (6)UV (254 nm)

SEC/MALS Analysis of Exosome (SB-806 HQ)

As an example of exosome (EV) analysis, the EV preparation process from cell culture supernatant was followed by a combination of polymer-based aqueous SEC (GFC) column OHpak SB-806 HQ and various detectors. UV 280 nm covers general culture-derived impurities, and fluorescence (Ex 280 nm / Em 348 nm) responds mainly to proteins via Trp residue fluorescence. In addition, MALS scattered light (LS) provides a highly sensitive response especially for large objects like nanoparticles. Also, MALS gives an estimate of the target RMS (root mean square) radius.
The fraction consisted mainly EV was separated from many culture-derived impurity components and was found around 8 minutes. While UV and fluorescence provide important insights into the progress and efficacy of the purification process and profiling of purified products, they are less sensitive to EVs mostly composed of lipid membranes and containing trace amounts of protein / nucleic acid cargo. It can be seen that LS is an effective EV tracking method, especially in the early stages of purification.
SB-806 HQ is a high-performance aqueous SEC (GFC) column suitable for bioproducts with a sufficient pore size to hold and separate EV-class nanoscale objects. Combined with a variety of detectors, it is useful for comprehensive analysis of the complex bio-nano target preparation process.

EV fraction preparation conditions
(1) Concentration step: Commercially available centrifugal ultrafiltration membrane 100 kDa (40 times concentrated)
(2) Affinity step: Commercial affinity purification kit (equivalent to 10-fold concentration)
Cooperation of sample preparation by Showa Denko Materials Co., Ltd.

s1967

 

Sample :
1. Cell culture supernatant 50 μL inj.
2. Concentrate 50 μL inj.
3. Crude product 15 μL inj.

Column       : Shodex OHpak SB-806 HQ (8.0 mm I.D. x 300 mm)　
Eluent       : PBS (-)
Flow rate    : 1.0 mL/min
Detector     : UV (280 nm)
               Fluorescence (Ex.280 nm, Em.348 nm)
               MALS (DAWN8+ produced by Wyatt Technology Corp.)
Column temp. : 25 °C

Analysis of Mannitol Injection Proposed in USP-NF Pharmacopeial Forum (SP0810)

According to the United States Pharmacopeia and the National Formulary Pharmacopeial Forum (PF 48(4)*), mannitol assay should be carried out with an HPLC and a column filled with L22 packing material, and meets following requirements. The use of SUGAR SP0810, a sugar analysis column, confirmed the requirements were met.

System suitability requirements:
Tailing factor: ≤ 2.0
Relative standard deviation (RSD): ≤ 2.0%

*The version at the time of the application acquisition.

s2054

 

Sample : 80 μL
1. USP Mannitol RS 2.5 mg/mL

Column       : Shodex SUGAR SP0810 (8.0 mm I.D. x 300 mm)
Eluent       : H2O
Flow rate    : 1.0 mL/min
Detector     : RI
Column temp. : 80 ℃

 

Analysis of Contaminants Sucrose and Sorbitol in Cranberry Juice According to USP-NF Method (SC1011-7F)

According to the United States Pharmacopeia and the National Formulary (USP-NF 2022 ISSUE 3* Effective December 1, 2022), analysis of contaminants sucrose and sorbitol in cranberry juice should be carried out with a column with L19 packing material and meets following requirements. The EP SC1011-7F confirmed the requirements were met.

System suitability requirements:
Resolution of sucrose and sorbitol: ≥ 1.8
Relative standard deviation (RSD): ≤ 2.0 %

*The version at the time of the application acquisition.

s2053

Sample :
0.1 mg/mL each, 20 μL
1. Sucrose
2. Sorbitol

Columns      : Shodex EP SC1011-7F (7.8 mm I.D. x 300 mm)
Eluent       : H2O
Flow rate    : 0.5 mL/min
Detector     : RI
Column temp. : 85 ℃

Simultaneous Analysis of Water-Soluble Vitamins (DE-413)

Ten kinds of water-soluble vitamins were simultaneously analyzed using RSpak DE-413, a polymer-based reversed phase chromatography column.

Note: we recommend 2X DE-413 in tandem for better simultaneous separation.

s2051

Sample : 10 μL

 

1. Vitamin B1 200 µM
2. Vitamin B6 200 µM
3. Niacinamide 200 µM
4. Vitamin C 200 µM
5. Vitamin B3 200 µM
6. Vitamin B5 200 µM
7. Vitamin B12 200 µM
8. Vitamin B2 200 µM
9. Biotin 800 µM
10. Folic acid 20 µM

 

Columns      : Shodex RSpak DE-G 4A (4.6 mm I.D. x 10 mm) + DE-413 (4.6 mm I.D. x 150 mm)
Eluent       : (A); 10 mM H3PO4 aq./(B); CH3CN
               High pressure linear gradient;
               (B %) 0 % to 20 % (0 to 15 min), 20 % (15 to 16 min), 0 % (16.01 to 25 min)
Flow rate    : 1.0 mL/min
Detector     : PDA (190 - 400 nm)
Column temp. : 40 ℃

Analysis of Oxyhalides in Artificial-Drinking Water According to EPA Method 300.1 (SI-37 4D)

The United States Environmental Protection Agency (EPA) Method 300.1 specifies methods for anion analysis in drinking water. EPA Method 300.1 has two parts. Part A: analysis of common ions and Part B: analysis of inorganic disinfection byproducts. Both uses the same analysis methods.

This application shows the example analysis of artificial-drinking water (standards spiked) following the EPA Method 300.1. With an IC SI-37 4D, an anion analysis column, analysis of common anions and inorganic disinfection byproducts (oxyhalides) is completed within 30 minutes. Moreover, it is capable of providing high sensitivity analysis of oxyhalides.

Please use this column with suppressor type ion chromatography system.

s2052

Sample : 200 μL (simulated drinking water containing EDA 50mg/L)

1. F– 1.0 mg/L 2. ClO2– 5 µg/L 3. BrO3– 5 µg/L 4. Cl– 50 mg/L 5. NO2– 5 µg/L 6. DCA–, Dichloroacetate
1 mg/L 7. ClO3– 5 µg/L 8. Br– 5 µg/L 9. NO3– 10 mg/L 10. CO32- 25 mg/L 11. SO42- 50 mg/L 12. PO43- 0.20 mg/L

s2052b

Columns      : Shodex IC SI-90G (4.6 mm I.D. x 10 mm) + SI-37 4D (4.0 mm I.D. x 150 mm)
Eluent       :  (Gradient) KOH aq.
                10 mM (0 to 21 min), 45 mM (21.01 to 30 min)
                (Eluent source : DionexTM EGC 500 KOH)
Flow rate    : 0.5 mL/min
Detector     : Suppressed conductivity
Column temp. : 30 °C

Separation of Phosphorylated Analytes (VN-50 4D)

HILICpak VN-50 4D, a polymer-based HILIC mode column, was used to analyze and successfully separate three analytes and their phosphorylated forms. VN-50 4D retains polar substances, which are not retained well by regular reversed-phase mode ODS columns. Thus, it is suitable for the analysis of sugars, sugar intermediates, and phosphorylated compounds with high polarity. Analytes studied were Glucose, D-Ribose, Pyruvate, and their respective phosphorylated compounds. From the chromatograms, we see the non-phosphorylated analytes elute first on the VN-50 4D, while the phosphorylated analytes eluate later due to them being higher charged species. For the pyruvate and phosphoenolpyruvate analysis, we want to note that pyruvate did not retain on the column too long because of its low charged state. Lastly, the asterisks shown are phosphate impurities found in the phosphorylated samples.

Sugar VN 50 4

Column       : Shodex HILICpak VN-50 4D (4.6mmI.D. x 150mm each)
Eluent       : 70% Acetonitrile, 30% 50mM Ammonium Bicarbonate
Flow rate    : 1 mL/min
Detector     : Shodex RI
Column temp. : 30°C

Separation of Ascorbic Acid and Isoascorbic Acid (DE-413)

Ascorbic acid and isoascorbic acid were separated using two columns of RSpak DE-413 (a column for polymer-based reversed phase chromatography). The calibration curve of ascorbic acid and isoascorbic acid shows good linearity respectively in the range from 1 to 100 μg/mL.

Sample : 10 μL
5 μg/mL each (in 0.1 % metaphosphoric acid)
1. Ascorbic acid
2. Isoascorbic acid

s2046

s2046b

Column       : Shodex RSpak DE-413 (4.6 mm I.D. x 150 mm) x 2
Eluent       : 10 mM H3PO4 aq.
Flow rate    : 0.6 mL/min
Detector     : UV (254 nm)
Column temp. : 40 ℃

Analysis of Oligonucleotides and Their Impurities (2) Base Alteration (VN-50 2D)

In R&D and QC of nucleic acid drugs such as antisense nucleic acids require development of analytical methods that separate the target synthetic oligonucleotide from its impurities as much as possible. In this application, four compounds were analyzed using HILICpak VN-50 2D, a polymer-based HILIC column. The four compounds were 20mer synthetic oligo-DNAs: one with the target base sequence and its three analogs with 1 to 3 base alterations. By having different bases make their hydrophilicities different from each other. Four synthetic oligo-DNAs were separated by HILIC mode using this hydrophilicity differences. The application developed here does not require a use of ion-pairing reagent nor highly concentrated salt in the eluent. Therefore, it is suitable for LC/MS analysis of oligonucleotides.

Sample : Synthesized oligo-DNAs (crude),1 μL

1. 20mer, ATACCGATTAAGCGAAGTTT

2. 20mer, ATACCGATTAAGCGAATTTT

3. 20mer, ATACCGATTAAGCTAATTTT

4. 20mer, ATACCGATTAATCTAATTTT

s2049

Column       : Shodex HILICpak VN-50 2D (2.0 mm I.D. x 150 mm)
Eluent       : (A)50 mM HCOONH4 aq. /(B) CH3CN
               Linear gradient ;
               (B %) 62 to 56 % (0 to 10 min), 56 % (10 to 20 min),
                     56 to 62 % (20 to 20.01 min), 62 % (20.01 to 25 min)
Flow rate    : 0.2 mL/min
Detector     : UV (260 nm) (small cell volume), ESI-MS (SIM Negative)
Column temp. : 60 ℃