Analysis of 10 – 50mer Oligo-DNAs (VN-50 2D)

Synthetic oligo-DNAs of 10, 20, 30, 40, and 50mer were analyzed using HILICpak VN-50 2D. Under the given condition, the oligo-DNAs eluted in an order of shorter to longer-chains. Optimization of the gradient condition improved the separations of longer chain oligo-DNAs. A simple analytical condition used in this application does not require ion-pair reagents nor highly concentrated salts for the separation and analysis of oligo-DNAs.

Sample : 0.02 mg/mL each (in H₂O), 1 μL
1. Synthesized oligo-DNA 10mer(crude),
TTCTTCGGAA
2. Synthesized oligo-DNA 20mer(crude),
CTTCTCATGGTTCTTCGGAA
3. Synthesized oligo-DNA 30mer(crude),
TGTTGTCATACTTCTCATGGTTCTTCGGAA
4. Synthesized oligo-DNA 40mer(crude),
CCACACCGGCTGTTGTCATACTTCTCATGGTTCTTCGGAA
5. Synthesized oligo-DNA 50mer(crude),
GACAACAGCCCCACACCGGCTGTTGTCATACTTCTCATGGTTCTTCGGAA

Column       : Shodex HILICpak VN-50 2D (2.0 mm I.D. x 150 mm)
Eluent       : (A)50 mM HCOONH4 aq. (pH9.8)/(B) CH3CN
               Linear gradient ;
               (a) 60 % B (0 min) to 50 % B (10 to 20 min) to 60 % B (20.01 to 25 min)
               (b) 65 % B (0 min) to 45 % B (10 to 20 min) to 65 % B (20.01 to 25 min)
Flow rate    : 0.2 mL/min
Detector     : UV (260 nm) (small cell volume)
Column temp. : 40 °C